image
78 comments
Some dinosaurs had feathers.
Oh, fuck it.
Exactly what "increase in information" would be needed to grow feathers? Has anyone ever tried to figure that out? And sure we observe increases in information. Down's syndrome is technically an "increase in information". It's not a desired increase or a helpful increase, but it's an increase nonetheless.
It would seem answers in genesis is unaware of
And various other observed, and quite common, examples of increase in genetic information.
How many times do you think the Answers in Genesis staff have had the reason this is wrong explained to them and just ignored it? I guess that is just a case of a loss of information.
Also, just so creationists don't say that no one could find why it's wrong. Gene duplication is a well documented phenomenon which creates another copy of an existing gene, which can mutate like crazy without detriment to the organism because they have another copy of the original gene. This effectively adds new information.
So, micro-organisms have always been multi resistant against antibiotics, they were just too dumb to use it before now?
Dinosaurs didn't decide over-night to become birds. They were around for almost 200 million years and had ample time to edge towards birdism, one millimeter per generation.
Show a creationist a point mutation and they'll likely as not claim that this represents a loss of information, or at the very least no gain in info.
AAAAAAAAAAAAAAA -> AAAAAAAAAAAAAAT (no gain)
Show a creationist a duplication event and they'll say that's not gain of information either because it's just the same sequence as before only twice.
AAAAAAAAAAAAAAT -> AAAAAAAAAAAAAATAAAAAAAAAAAAAAT (no gain)
But combine a couple of thousand duplications and point mutations and they'll say the end result is impossible because information can't come from nowhere, despite they themselves claiming that none of the intermediate steps increases information.
1: AAAAAAAAAAAAAAT AAAAAAAAAAAAAAT
So which has more information, "AAAAAAAAAAAAAAA" or "ACCTAAAGATAATGTTAAAGCTATA CTGATCCGTCGGTTCACGCTCCATG AGAGAAACCTGTCTCTTAGTCCGAA CGGCGTTAGAGTGGAGCCCGCCCCG TAGAGAGCCTGCTTTGACGGCTATC TAGGTTCTGTAATTGAGGAACGATC"?
According to creationists the answer is the first one, because the second one is has lost information through mutation.
Sigh. DNA doesn't literally contain blueprints and data. It's made up of a series of proteins, which affect changes in the body via chemical reactions. It's more than possible to have a duplication within the "code", leading to "more information".
Incidentally, the majority of evolutionary changes are made up of alterations in the existing DNA, not the addition of new proteins. You needn't add new information to develop feathers, hair, wings, etc. -- all are alterations of the existing DNA.
And for the record, humans have fewer base pairs than amoebas do. We also have one fewer chromosomes than the other apes due to two of them fusing early in our evolution.
As a matter of fact, fish have more genes then any other vertebrates, amphibians have more genes then amnionts, and reptiles have more genes then birds and mammals. So in short, the amount of genetic information hasn't increased since the Ordovician.
It is impossible for a Creationist to absorb new information. Therefore, it is impossible for a Creationist to imagine or to admit that anyone or anything else has that capability. Creationists substitute demonstrably false statements for fact with the expectation that they will be believed without question or supporting evidence. This is because they have a double-dominant Stupid gene. /sarcasm
"As a matter of fact, fish have more genes then any other vertebrates, amphibians have more genes then amnionts, and reptiles have more genes then birds and mammals. So in short, the amount of genetic information hasn't increased since the Ordovician."
And a single-celled amoeba has more genetic information than any of those.
Where do you fundies get this shit?
A) An increase in genetic information happens frequently. It's a common and well-known type of mutation.
B) I'm not familiar with the genetic theory behind scales to feathers, but it's entirely possible that it didn't require an increase, just a change in existing information. Even if it did require an increase, see my previous point.
Admit it. You're an idiot who doesn't know the first thing about science, and chooses to revel in the ignorance of a thousand-year-old book that knew less than anything we know today.
@Doubting Thomas
I think it's hilarious that these fundies think that writing comic strips and Chick tracts are the best way to get their points across. Meanwhile, the scientific world is using big words in peer-reviewed papers. are better at making a point to a lay audience.
Hey, Dan LIE-tha, I hope you never contract MRSA. Then again, it cannot exist, right?
DNA isn't like a dump truck, it's a series of tubes!
From what I understand, it doesn't matter how much DNA you have, what matters is what you do with it.
But then, I'm a college-educated atheist liberal. I just don't understand the truths of the bible.
I admit that, as a loyal servant of Jesus, I am not above telling lies or spreading false information on His behalf. As a saved minion of Jesus I have special dispensation from God, with my pastor's agreement of course, to say and do whatever it takes to keep His flock on the straight and narrow. The important thing is to keep on faithing.
The really great thing about being a believer is that you can enjoy your gullibility without any nagging feelings of leaving your common sense behind. Indeed, common sense is just that, common, whereas virtuous lying is Godly. I have carte blanch from God, via the auspices of my pastor, to say or do anything at all if it furthers His just causes.
Good point.
Or it would be except that feathers and scales are pretty much made of the same material (keratine),a protein that can form very different shapes and structures depending on very small changes in the genes telling the protein how to fold.
Ohand sometimes nature does see an increase in information.
In short, You fail Biology.
Science has never observed such an increase of information...
I know being creationists you are pig ignorant but perhaps you should look up gene duplication. this process adds information to the genome, nylonaise in bacteria demonstrates a classic example of new information being added to the genome and creating novel proteins.
Ignoring all of the examples which demonstate an increase of information does not make them go away
We have the feathered fossils (and tons of them: pretty much the entire Maniraptora, a number of coelurosaurs including at least one primitive tyrannosaur, and at least two feathered species of ornithisichian as well). We fucking win.
These comics are terrible.
I hate this one in particular:
image
Um, do they fail to see the giant TRUNK on the elephant? Do they read Hebrew? Do they KNOW "tail" couldn't have meant trunk?
@IceKeyHunter:
That comic deserves a post all of it's own...
"Behold now behemoth [...] Lo now, his strength is in his loins and his force is in the navel of his belly"
Dinosaurs hatch from eggs, they don't have navels, which are the remnants of the umbilical cord characteristic of placental mammals.
Their own supposedly infallible book is telling them they are wrong and still they don't believe it.
That's actually not an example of loss of information. The scales evolved into feathers.
Additionally, since the vast majority of our present genetic code does ~nothing~, who is to say that parts that do nothing can't alter to do something?
He moveth his tail like a cedar: the sinews of his stones are wrapped together.
Notice how they jump on the "tail like a cedar" ignore the "stones". If "stones" refers to testicles, reptiles, birds and other dinosaurs don't have 'em (externally).
(actually, "stones" may be a KJV mistranslation. Other versions say "thighs").
*facepalm*
Fun fact of the day: The human genome contains approximately 23,000 genes - the same number as a chicken, less than an ear of corn.
Source: http://video.pbs.org/video/1372073556
AIG Lies about everthing.. Here is a a great example.. they took a line from a scientists research which in the magazine "The mysterey of the missing Supernova has been solved" and completely eliminated the has been solved. Aig also has questionable accounting practices, is known to plagarize, steal and use material for their own "brain washing " of unsuspecting victims
Confused?
So were we! You can find all of this, and more, on Fundies Say the Darndest Things!
To post a comment, you'll need to Sign in or Register . Making an account also allows you to claim credit for submitting quotes, and to vote on quotes and comments. You don't even need to give us your email address.
